SmallRNAPrep

Uses FASTX-Toolkit to perform adapter trimming, artifact filtering, base-quality filtering, and read trimming for single-end read data. This function is executed within the larger QCFasta component when parameter tool=fastx.

Version	1.0
Bundle	sequencing
Categories	Preprocessing smallRNA
Authors	Katherine Icay (katherine.icay@helsinki.fi)
Issue tracker	View/Report issues
Requires	FASTX-Toolkit
Source files	component.xml function.scala
Usage	Example with default values SmallRNAPrep( reads = FASTQ, Lmax = 32, Lmin = 15, M = 6, adapter = "ATCTCGTATGCCGTCTTCTGCTT", extra = "-n", minPercent = 20, minQ = 30, qual = "-Q64", zip = false )

Inputs

Name	Type	Mandatory	Description
reads	FASTQ	Mandatory	Input file in FASTQ format.

Outputs

Name	Type	Description
fastq	FASTQ	Trimmed, high-quality reads. Must be in fastq/fq format and should not be zipped.
stats	CSV	Count statistics of reads before and after processing.

Parameters

Name	Type	Default	Description
Lmax	int	32	Maximum acceptable sequence length.
Lmin	int	15	Minimum acceptable sequence length.
M	int	6	Minimum, partial adapter match length needed for removal to occur.
adapter	string	"ATCTCGTATGCCGTCTTCTGCTT"	Adapter sequence to remove. Default is Illumina smallRNA-seq adapter. Value of "NA" will disable trimming and just calculate total read lengths per sample.
extra	string	"-n"	Extra parameters for `fastx_clipper`. E.G. "-n" keeps sequences with N, "-c" discards non-clipped sequences.
minPercent	int	20	Minimum percentage of bases that must have at least `minQ` for a read to be kept.
minQ	int	30	Minimum quality score to keep.
qual	string	"-Q64"	Type of quality scores of sequences: -Q64 for Sanger scores, -Q33 for Phred scores.
zip	boolean	false	Defines if the output sequences should be gzipped or not.

Test cases

Test case	Parameters▼	IN reads	OUT fastq	OUT stats
case1	(missing)	reads	(missing)	(missing)

Generated 2019-02-08 07:42:21 by Anduril 2.0.0